RNA Pseudoknotted Secondary Structure Prediction Using Relaxed Hierarchical Folding
Software implementation of Iterative HFold.
Iterative HFold is an algorithm for predicting the pseudoknotted secondary structures of RNA using relaxed Hierarchical Folding.
Paper: Jabbari, H., Condon, A. A fast and robust iterative algorithm for prediction of RNA pseudoknotted secondary structures. BMC Bioinformatics 15, 147 (2014). https://doi.org/10.1186/1471-2105-15-147 (https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-15-147)
On the dataset tested in this paper, Iterative HFold generally has better accuracy that its predecessor, HFold.
Linux, macOS
conda install -c uvic-cobra iterative-hfold
Works for Linux and macOS
Requirements: A compiler that supports C++11 standard (tested with g++ version 4.9.0 or higher), Pthreads, and CMake version 3.1 or greater.
CMake version 3.1 or greater must be installed in a way that HFold can find it.
To test if your Mac or Linux system already has CMake, you can type into a terminal:
cmake --version
If it does not print a cmake version greater than or equal to 3.1, you will have to install CMake depending on your operating system.
Easiest way is to install homebrew and use that to install CMake.
To do so, run the following from a terminal to install homebrew:
/bin/bash -c "$(curl -fsSL https://raw.githubusercontent.com/Homebrew/install/HEAD/install.sh)"
When that finishes, run the following from a terminal to install CMake.
brew install cmake
Run from a terminal
wget http://www.cmake.org/files/v3.8/cmake-3.8.2.tar.gz
tar xzf cmake-3.8.2.tar.gz
cd cmake-3.8.2
./configure
make
make install
If you need to specify a specific compiler, such as g++, you can instead run something like
cmake -H. -Bbuild
cmake --build build
This can be useful if you are getting errors about your compiler not having C++11 features.
cmake -H. -Bbuild -DCMAKE_CXX_COMPILER=g++
cmake --build build
After installing you can move the executables wherever you wish, but you should not delete or move the simfold folder, or you must recompile the executables. If you move the folders and wish to recompile, you should first delete the created “build” folder before recompiling.
Arguments:
HFold_iterative:
-r <structure>
-i </path/to/file>
-o </path/to/file>
-v
-V
-n <number of outputs>
-p
Remarks:
make sure the <arguments> are enclosed in "", for example -r "..().." instead of -r ..()..
The sequence does not need to be enclosed and can be given before or after the other arguments
if no structure is provided through -r , the input structure will be the hotspot with the lowest free energy
if -i is provided with just a file name without a path, it is assuming the file is in the diretory where the executable is called
if -o is provided with just a file name without a path, the output file will be generated in the diretory where the executable is called
if -v is provided, a verbose output will be given (method used is outputted)
if -V is provided, the version is given
if -n is provided with a number, it will modify the number of hotspots looked and outputs given (the base is 1)
if -p is provided, it will change the output to pseudoknot-free
Sequence requirements:
containing only characters GCAUT
Structure requirements:
-pseudoknot free
-containing only characters ._(){}[]
Remarks:
Restricted structure symbols:
() restricted base pair
_ no restriction
Input file requirements:
Line1: Name (optional, but must be fasta format; ignored in final input)
Line2: Sequence (required)
Line3: Structure (optional)
sample:
>Srp_005
GCAACGAUGACAUACAUCGCUAGUCGACGC
(____________________________)
assume you are in the directory where the Iterative-HFold executable is loacted
./Iterative-HFold -i "/home/username/Desktop/myinputfile.txt"
./Iterative-HFold -i "/home/username/Desktop/myinputfile.txt" -o "outputfile.txt"
./Iterative-HFold -i "/home/username/Desktop/myinputfile.txt" -o "/home/username/Desktop/some_folder/outputfile.txt"
./Iterative-HFold GCAACGAUGACAUACAUCGCUAGUCGACGC -r "(____________________________)"
./Iterative-HFold GCAACGAUGACAUACAUCGCUAGUCGACGC -r "(____________________________)" -o "outputfile.txt"
./Iterative-HFold GCAACGAUGACAUACAUCGCUAGUCGACGC
./Iterative-HFold GCAACGAUGACAUACAUCGCUAGUCGACGC -n 10
./Iterative-HFold GCAACGAUGACAUACAUCGCUAGUCGACGC -p
0 success
1 invalid argument error
3 thread error
4 i/o error
5 pipe error
6 positive energy error
error code with special meaning: http://tldp.org/LDP/abs/html/exitcodes.html
2 Misuse of shell builtins (according to Bash documentation)
126 Command invoked cannot execute
127 "command not found"
128 Invalid argument to exit
128+n Fatal error signal "n"
130 Script terminated by Control-C
255 Exit status out of range (range is 0-255)